Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences
- 1 October 1983
- journal article
- research article
- Published by American Society for Microbiology in Journal of Bacteriology
- Vol. 156 (1), 327-337
- https://doi.org/10.1128/jb.156.1.327-337.1983
Abstract
AmyR2, amyE+ and aroI+ alleles from an .alpha.-amylase-hyperproducing strain, B. subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1776 base pairs (592 amino acids). Among the 1776 base pairs, 1674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the .alpha.-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the .alpha.-amylase was slightly faster than that of the parental .alpha.-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence. The DNA sequence of the mature extracellular .alpha.-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was different from the promoter region of the B. subtilis 168 .alpha.-amylase gene which was cloned in the Escherichia coli vector systems.This publication has 25 references indexed in Scilit:
- Nucleotide sequence of the promotor and NH2-terminal signal peptide region of Bacillussubtilis α-amylase gene cloned in pUB110Biochemical and Biophysical Research Communications, 1983
- Construction and physical map of a Bacillus subtilis specialized transducing phage .RHO.11 containing B. subtilis lys+ gene.The Journal of General and Applied Microbiology, 1982
- Nucleotide sequence of the promoter and NH2-terminal signal peptide region of the α-amylase gene from Bacillus amyloliquefaciensGene, 1981
- Transfer of Proteins Across MembranesAnnual Review of Biochemistry, 1981
- A Comprehensive Molecular Map of Bacteriophage LAMBDAGene, 1979
- A method for construction of specialized transducing phage ϱ11 of Bacillus subtilisGene, 1979
- Complete Nucleotide Sequence of the Escherichia coli Plasmid pBR322Published by Cold Spring Harbor Laboratory ,1979
- Transfer of proteins across membranes. I. Presence of proteolytically processed and unprocessed nascent immunoglobulin light chains on membrane-bound ribosomes of murine myeloma.The Journal of cell biology, 1975
- Membrane mutation related to the production of extracellular α-amylase and protease in BacillussubtilisBiochemical and Biophysical Research Communications, 1973
- PARTICIPATION OF A REGULATOR GENE IN THE α-AMYLASE PRODUCTION OF BACILLUS SUBTILISThe Journal of General and Applied Microbiology, 1969