2,2,5,5-Tetramethylpyrrolidin-3-one-1-sulfinyl Group for 5‘-Hydroxyl Protection of Deoxyribonucleoside Phosphoramidites in the Solid-Phase Preparation of DNA Oligonucleotides

Abstract

Several nitrogen−sulfur reagents have been investigated as potential 5‘-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen−sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5‘-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5‘-sulfamidite group in the synthesis of 5‘-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2‘-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5‘-hydroxyl protection of phosphoramidites, such as 10a − d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.