A Practical Synthesis ofN1-Methyl-2′-deoxy-ψ-uridine (ψ-Thymidine) and Its Incorporation into G-Rich Triple Helix Forming Oligonucleotides
- 1 August 1995
- journal article
- research article
- Published by Informa UK Limited in Nucleosides and Nucleotides
- Vol. 14 (6), 1269-1287
- https://doi.org/10.1080/15257779508010690
Abstract
A convenient synthesis of N1-methyl-2′-deoxy-ψ-uridine (ψ-thymidine, ψT, 7a) has been accomplished in good yield. The structural conformation of 7a was derived by 2D NMR and 1D NOE experiments. The nucleoside 7a has been incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of the modified TFOs (S4, S5 and S6) containing ψT has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(CTGAGACCGGGAAGGAGGAAGGGCCAGTGAC)3′-5′d(GACTCTGGCCCTTCCTCCTTCCCGGTCACTG)3′(D1) at pH 7.6. The triplex formation of modified homopyrimidine-oligomers (S1, S2 and S3) has also been studied in parallel motif with a duplex-10 (A10:T10) at pH 7.0.Keywords
This publication has 32 references indexed in Scilit:
- Sequence‐Specific Recognition and Modification of Double‐Helical DNA by OligonucleotidesAngewandte Chemie-International Edition, 1993
- Human therapeutics based on triple helix technologyTrends in Biotechnology, 1992
- Oligonucleotides as therapeutic agentsPharmacology & Therapeutics, 1991
- Antisense agents in pharmacologyBiochemical Pharmacology, 1990
- Specific regulation of gene expression by antisense, sense and antigene nucleic acidsBiochimica et Biophysica Acta (BBA) - Gene Structure and Expression, 1990
- Antisense oligonucleotides: a new therapeutic principleChemical Reviews, 1990
- Conjugates of oligonucleotides and modified oligonucleotides: a review of their synthesis and propertiesBioconjugate Chemistry, 1990
- Site-Specific Oligonucleotide Binding Represses Transcription of the Human c- myc Gene in VitroScience, 1988
- Sequence-specific binding and photocrosslinking of alpha and beta oligodeoxynucleotides to the major groove of DNA via triple-helix formation.Proceedings of the National Academy of Sciences, 1988
- Sequence-Specific Cleavage of Double Helical DNA by Triple Helix FormationScience, 1987