The Nucleotide Sequence of 5S Ribosomal RNA from Slime Mold Physarum polycephalum
- 1 October 1981
- journal article
- research article
- Published by Oxford University Press (OUP) in The Journal of Biochemistry
- Vol. 90 (6), 1577-1581
- https://doi.org/10.1093/oxfordjournals.jbchem.a133631
Abstract
The nucleotide sequence of 5S ribosomal RNA from plasmodia of the slime mold Physarum polycephalum was determined as pppGGAUGCGGCAUACUAAGGGAAAGCACCCAUCCCGUCGAUCUGAGAGUUAAGCUCUUCAGGCGUGUUAGUACUGGGUGGGGGCCACCUGGGAUCCCACGUCUGCAUUCU by chemical and enzymatic gel sequencing technics using 3′ and 5′ end-labeled RNA. This RNA is very different from 5S rRNA of the cellular slime mold Dictyostelium discoideum (36 nucleotides are different), and shows greater similarity to 5S rRNM from Protozoa and Metazoa than to those from fungi.
Keywords
This publication has 5 references indexed in Scilit:
- The Nucleotide Sequence of 5S Ribosomal RNA from Schizosaccharomyces pombeThe Journal of Biochemistry, 1981
- Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA.Proceedings of the National Academy of Sciences, 1981
- Nucleotide Sequence of 5S Ribosomal RNA from the Posterior Silk Glands of Bombyx moriThe Journal of Biochemistry, 1981
- Nucleotide Sequence of 5S Ribosomal RNA from Lingula anatina1The Journal of Biochemistry, 1980
- Direct chemical method for sequencing RNA.Proceedings of the National Academy of Sciences, 1979