The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach
- 25 June 1981
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 9 (12), 2801-2805
- https://doi.org/10.1093/nar/9.12.2801
Abstract
Spinacia oleracia chloroplast 5S ribosomal RNA was end-labeled with [ 32 P] and the complete nucleotide sequence was determined. The sequence is: pUAUU CUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAUACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUG OH .Keywords
This publication has 13 references indexed in Scilit:
- Nucleotide sequence of a spinach chloroplast threonine tRNA.Journal of Biological Chemistry, 1980
- The nucleotide sequence of a major species of leucine tRNA from bovine liver.1980
- Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plantsBiochemical Journal, 1979
- A different approach to RNA sequencingNature, 1978
- Studies on the Sequence of the 3′‐Terminal Region of Turnip‐Yellow‐Mosaic‐Virus RNAEuropean Journal of Biochemistry, 1977
- Mapping adenines, guanines, and pyrimidines in RNANucleic Acids Research, 1977
- Evidence for the Nucleotide Sequence of 5‐S rRNA from the Flowering Plant Secale cereale (Rye)European Journal of Biochemistry, 1976
- 5S RNA secondary structureNature, 1975
- The nucleotide sequence of 5 S rRNA from the blue‐green alga Anacystis nidulansFEBS Letters, 1974
- Use of DNA Polymerase I Primed by a Synthetic Oligonucleotide to Determine a Nucleotide Sequence in Phage f1 DNAProceedings of the National Academy of Sciences, 1973