A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only
- 1 March 1981
- journal article
- research article
- Published by Portland Press Ltd. in Bioscience Reports
- Vol. 1 (3), 235-241
- https://doi.org/10.1007/bf01114910
Abstract
Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the ‘severe’ strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 9mild9 strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.Keywords
This publication has 16 references indexed in Scilit:
- Viroids: A Class of Subviral PathogensAngewandte Chemie International Edition in English, 1980
- Structure and structure formation of viroidsJournal of Molecular Biology, 1979
- Nucleotide sequence and secondary structure of potato spindle tuber viroidNature, 1978
- Common structural features of different viroids: serial arrangement of double helical sections and internal loopsNucleic Acids Research, 1978
- Citrus exocortis viroid: Survey of protein synthesis in Xenopus laevis oocytes following addition of viroid RNAVirology, 1977
- Comparative oligonucleotide fingerprints of three plant viroidsNucleic Acids Research, 1977
- Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures.Proceedings of the National Academy of Sciences, 1976
- Comparative studies of two viroids: Analysis of potato spindle tuber and citrus exocortis viroids by RNA fingerprinting and polyacrylamide-gel electrophoresisVirology, 1975
- Functional distinctions between the ribonucleic acids from citrus exocortis viroid and plant viruses: Cell-free translation and aminoacylation reactionsVirology, 1974
- Potato spindle tuber viroid. XII. An investigation of viroid RNA as a messenger for protein synthesisVirology, 1974