Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment
- 1 January 1975
- journal article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 2 (11), 2091-2100
- https://doi.org/10.1093/nar/2.11.2091
Abstract
A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').Keywords
This publication has 11 references indexed in Scilit:
- Studies on bacteriophage fd DNA: II. Localization of RNA initiation sites on the cleavage map of the fd genomeJournal of Molecular Biology, 1975
- Nucleotide sequence of an RNA polymerase binding site at an early T7 promoter.Proceedings of the National Academy of Sciences, 1975
- Nucleotide sequence of an RNA polymerase binding site from the DNA of bacteriophage fd.Proceedings of the National Academy of Sciences, 1975
- Genetic Regulation: The Lac Control RegionScience, 1975
- Nucleotide Sequence in the Promoter Region of the Escherichia coli Tyrosine tRNA GeneProceedings of the National Academy of Sciences, 1974
- Sequence of a represser-binding site in the DNA of bacteriophage λNature, 1974
- The nucleotide sequence preceding an RNA polymerase initiation site on SV40 DNA. Rart 2. The sequence of the early strand transcriptNucleic Acids Research, 1974
- 5 s RNA Conformation. Studies of its Partial T1 Ribonuclease Digestion by Gel Electrophoresis and Two-dimensional Thin-layer ChromatographyJournal of Molecular Biology, 1972