The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri

Abstract
Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.