The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri
- 1 January 1980
- journal article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 8 (12), 2783-2786
- https://doi.org/10.1093/nar/8.12.2783
Abstract
Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.Keywords
This publication has 6 references indexed in Scilit:
- Compilation of tRNA sequencesNucleic Acids Research, 1980
- An improved direct RNA sequence method; its application to Vida faba 5.8S ribosomal RNANucleic Acids Research, 1980
- Phylogenetic analysis of the mycoplasmas.Proceedings of the National Academy of Sciences, 1980
- A different approach to RNA sequencingNature, 1978
- The mycoplasmas.1978
- The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capriNucleic Acids Research, 1978