The SS ribosomai RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the SS RNA of the trypanosomatid protozoa
- 11 December 1981
- journal article
- research article
- Published by Oxford University Press (OUP) in Nucleic Acids Research
- Vol. 9 (23), 6627-6633
- https://doi.org/10.1093/nar/9.23.6627
Abstract
The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5′GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUACUGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUU 0H 3′This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomai RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasiculata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomai RNAs.Keywords
This publication has 16 references indexed in Scilit:
- The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinachNucleic Acids Research, 1981
- The nucleotide sequence of Euglena cytoplasmic phenylalanine transfer RNA. Evidence for possible classification of Euglena among the animal rather than the plant kingdomNucleic Acids Research, 1981
- The nucleotide sequence of a major species of leucine tRNA from bovine liver.1980
- Collection of published 5S and 5.8S rRNA sequences and their precursorsNucleic Acids Research, 1980
- The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideumNucleic Acids Research, 1980
- Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plantsBiochemical Journal, 1979
- Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.Proceedings of the National Academy of Sciences, 1979
- A different approach to RNA sequencingNature, 1978
- Origins of Prokaryotes, Eukaryotes, Mitochondria, and ChloroplastsScience, 1978
- Mapping adenines, guanines, and pyrimidines in RNANucleic Acids Research, 1977